DNA / RNA Reverse Complement
Paste a DNA or RNA sequence and get the reverse complement instantly — full IUPAC ambiguity support, FASTA-aware, case preserved. Runs entirely in your browser, nothing is uploaded.
What this tool does
Paste a DNA or RNA sequence and get its reverse complement — the opposite strand, read in the usual 5'→3' direction. Each base is swapped for its partner (A↔T, C↔G, and U pairs with A) and the order is flipped. You can also ask for the complement only (no flip) or the reverse only (no complementing).
Everything runs locally in your browser tab as WebAssembly: your sequence is never uploaded, the tool works offline, and there is no sign-up.
The IUPAC nucleotide alphabet
Ambiguity codes are handled in full, using the standard IUPAC pairing. Note that S and W are their own complements — a classic source of wrong answers in hand-written tables.
| Code | Means | Complement |
|---|---|---|
A | adenine | T (or U) |
C | cytosine | G |
G | guanine | C |
T / U | thymine / uracil | A |
R | A or G (purine) | Y |
Y | C or T (pyrimidine) | R |
S | G or C | S |
W | A or T | W |
K | G or T (keto) | M |
M | A or C (amino) | K |
B | C, G or T (not A) | V |
D | A, G or T (not C) | H |
H | A, C or T (not G) | D |
V | A, C or G (not T) | B |
N | any base | N |
- / . | alignment gap | unchanged |
Options
| Option | What it does |
|---|---|
| Operation | Reverse complement (default) complements and flips — the opposite strand. Complement only swaps bases in place. Reverse only flips the order without swapping. |
| Output alphabet | Auto (default) keeps the input's alphabet: RNA out if the input has U and no T, otherwise DNA. DNA writes U as T; RNA writes T as U. |
| Preserve case | On by default, so lower-case regions (often used to mark repeats, primers or UTRs) stay marked. Turn it off to uppercase the whole output. |
| Wrap width | Split the output into fixed-width lines. 0 = one line per sequence; 60 is the usual FASTA convention. Maximum 200. |
| Unrecognised characters | Anything that is not a base, IUPAC code or gap. Report an error (default) names the character and its position; Remove them strips them; Pass them through leaves them in place. |
| Append length / GC summary | Adds # comment lines with the record count, length, GC content, ambiguous-code count and gap count. |
Worked examples
A plain sequence
Input:
ATGGCCATTGTAATGGGCCGC
Reverse complement:
GCGGCCCATTACAATGGCCAT
With Operation set to Complement only, the same input gives the partner base at every position without flipping the order:
TACCGGTAACATTACCCGGCG
Ambiguity codes
Input ACGTRYSWKMBDHVN reverse-complements to:
NBDHVKMWSRYACGT
FASTA in, FASTA out
Input (two records) with Wrap width 10:
>seq1 forward primer
ATGGCCATTGTAATGGGCCGC
>seq2
TTACGGATCC
Output — each record is transformed on its own and its header is kept:
>seq1 forward primer
GCGGCCCATT
ACAATGGCCA
T
>seq2
GGATCCGTAA
A numbered paste
Sequence copied out of a numbered listing, with Unrecognised characters set to Remove them and the summary switched on:
1 atggccatt 10 gtaatgggc
gives
gcccattacaatggccat
# sequences: 1
# length: 18
# gc_content: 50.00%
# ambiguous: 0
# gaps: 0
Note that the lower case is preserved and the position numbers are gone.
Limits and edge cases
- Input is capped at 1,000,000 characters — roughly a bacterial chromosome. Split larger genomes before pasting; a browser tab is bounded by your device's memory.
- Spaces, tabs and line breaks between bases are always ignored, so a wrapped or column-formatted paste works as-is. The output's line breaks come only from the wrap width.
- Wrap width must be
0–200. - Alignment gaps
-and.are kept and map to themselves, so a gapped alignment row round-trips. - With Auto alphabet, a sequence containing both
TandUis treated as DNA. Force the alphabet if that is not what you want. - FASTA is detected from any line starting with
>. Sequence appearing before the first header is still transformed, as a record with no header. - Reverse-complementing twice returns the original sequence — a quick way to check a result.
- The GC percentage counts only unambiguous bases (
A,C,G,T,U); ambiguity codes and gaps are excluded from both the numerator and the divisor.
FAQ
What is the difference between the reverse complement and the complement?
The complement swaps each base for its pairing partner but leaves the order alone, so position 1 stays at position 1. The reverse complement also flips the sequence end-to-end, which is what you want when you read the opposite strand in the standard 5'→3' direction — for designing a reverse primer, for example, or for finding an open reading frame on the minus strand.
How are IUPAC ambiguity codes complemented?
They follow the IUPAC convention, which you can read straight off the code table
above: R↔Y, K↔M, B↔V, D↔H, while S, W and N are their own
complements. S means "G or C", and the complement of "G or C" is "C or G" — the
same set — which is why it is unchanged. The same reasoning applies to W
("A or T").
Can I paste RNA, and what comes out?
Yes. With the Auto output alphabet (the default), a sequence containing U and
no T is treated as RNA and the result is written with U. Set the output
alphabet to DNA to get a T-based result from RNA input (handy for going back
to a cDNA sequence), or to RNA to transcribe a DNA result into U.
Does it handle multi-record FASTA files?
Yes. Any line starting with > begins a new record. Every record is transformed
independently, its header line is copied through unchanged, and the sequence lines
of a record are joined before transforming — so a file wrapped at 60 or 70
characters gives the right answer regardless of where the line breaks fall.
Why did it reject my sequence, and how do I fix it?
By default anything that is not a base, an IUPAC code, or a gap is an error, and
the message names the offending character and its position. That usually means the
paste carried along position numbers, a stop-codon *, or stray punctuation. Set
Unrecognised characters to Remove them to strip that noise, or to Pass them
through if the extra symbols are meaningful annotation you want to keep.
Is my sequence uploaded anywhere?
No. The transform is compiled to WebAssembly and runs inside your browser tab. Nothing is sent to a server, so the page also works with the network switched off once it has loaded — which matters for unpublished or patient-derived sequence.
Developer & Automation Access
Run it from the terminal
Same engine as this page, headless — via the gizza CLI:
gizza tool dna-reverse-complement ">seq1 example
ATGGCCATTGTAATGGGCCGC"New to the CLI? Get gizza →
Open it by URL
Pre-fill and auto-run this tool with query parameters — the names match the API/CLI:
https://gizza.ai/tools/dna-reverse-complement/?sequence=%3Eseq1%20example%0AATGGCCATTGTAATGGGCCGC&operation=reverse_complement&output_alphabet=auto&preserve_case=true&line_width=0&on_invalid=error&show_stats=trueMachine-readable descriptor: tool.json — title + parameters JSON Schema for agents.